Identification and analysis of mutated ALK in Neuroblastoma
Lab/Group: Olivier Delattre Lab, Institut Curie, Centre de Recherche/Inserm, U830, Paris, France
Related Journal & Article Information
Journal: Nature
Article Title: Somatic and germline activating mutations of the ALK kinase receptor in neuroblastoma
Introduction
Genome-wide comparative genomic hybridization analysis and subsequent direct sequencing of neuroblastoma cell lines and primary tumour DNAs allowed us to identify somatic mutations of the ALK-kinase domain. Germline mutations were observed in two neuroblastoma families indicating that ALK is a neuroblastoma predisposition gene. Mutated ALK proteins were over-expressed, hyperphosphorylated and exhibited constitutive kinase activity. The knock-down of ALK expression in ALK-mutated cells, but also in cell lines over-expressing a wild-type ALK, led to a dramatic decrease of cell proliferation. Here, we provide information about the reagents used in this study and describe the RNA interference method, immunoprecipitation protocol and in vitro kinase assay.
Materials
Reagents
- DNA sequencing was performed using the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems).
- Software: Sequences were analysed using SeqScape software (Applied Biosystems).
- Antibodies:
An antibody (# 3343, Cell signalling Technologies) directed against the phosphorylated Y1586 residue was used to reveal phosphorylated ALK.
Total ALK was detected using the monoclonal ALK1 (anti-human CD246, DakoCytomation) or polyclonal (Zymed) antibodies.
- Small Hairpin RNAs:
Control and ALK specific small hairpin RNAs in the pLKO puromycine resistant vector were purchased from Sigma (SIGMA Mission shRNA).
sh2854:
CCGGACCCAAATCAAGAAACCTGTTCTCGAGAACAGGTTTCTTGATTTGGGTTTTTT
sh5992:
CCGGGTGATAAATACAAGGCCCAGACTCGAGTCTGGGCCTTGTATTTATCACTTTTT
sh5706:
CCGGGAGCTGGTCATTACGAGGATACTCGAGTATCCTCGTAATGACCAGCTCTTTTT
- CalPhos™ Mammalian Transfection Kit (Clontech, Ozyme) contains CaCl2 and HBS2X
- Chloroquine (Sigma-Aldrich)
- 6 mg/ml Polybrene (Hexadimethrine bromide)(Sigma-Aldrich)
- Puromycine (Sigma-Aldrich)
- Crystal Violet Solution (Sigma-Aldrich)
- BioRad Protein Assay (BioRad)
- Protein G Sepharose 4B, fast flow (Sigma-Aldrich)
- Hybond nitrocellulose membranes (Amersham Pharmacia Biotech)
Equipment
ABI PRISM® 3130 Genetic Analyzer (Applied Biosystems).
Vi-cell XR counter (Beckman Coulter).
Procedure
■ Array-CGH experiments
Experiments were conducted as previously described on the Institut Curie one megabase resolution BAC-array (Fix et al., 2008; Vincent-Salomon et al., 2008). The RP11-328L16 BAC contains most of the ALK gene. SNP analyses were based on the 100K Affymetrix SNP arrays (GeneChip 50K array Hind and Xba).
■ Knock-down of ALK expression
● Production of viral particles
Day -1: 293T plating
1. 24h prior to transfection, plate 4×106 HEK293T cells /10 cm dish. 293T cells are maintained in DMEM 10% serum and 1% Penicillin/Streptomycin.
Day 0: Transfection
1. At least 30 min before the transfection, replace the medium with 9 ml of fresh DMEM medium complemented with 25 µM chloroquine and preheated at 37°C.
2. For one dish (10 cm dish), prepare the following transfection mix:
5 µg envelope plamid (pVSV-G codes for the VSV-G envelope)
10 µg packaging plasmid psPAX2
10 µg vector plasmid (lentiviral vector pLKO containing the shRNA of interest)
50 µl of CaCl2 2M
3. Briefly mix, then add 500 µl of HBS2X, dropwise under agitation by vortexing.
4. Wait for 20 min at RT.
5. Add the precipitate dropwise in each dish and mix gently by rotating the plate.
6. Remove medium around 7 hours post-transfection and put 10 ml/dish of fresh preheated medium.
Day 2: Supernatant collecting
1. Harvest supernatant containing the viral particles and filtrate on 0.45 µm. The clear supernatants can be kept at 4°C for 4-5 weeks.
● Transduction of the lentiviral constructs into neuroblastoma cells
Day -1: Neuroblastoma cells plating
1. Plate 4×105 neuroblastoma cells per well of 6-wells dishes. CLB-GA and CLB-MA cells are maintained in RPMI 10% serum and 1% Penicillin/Streptomycin. IMR32 and 106C cells are maintained in DMEM 10% serum and 1% Penicillin/Streptomycin.
Day 0: Transduction of the lentiviral constructs
1. Supplement 1 ml of viral supernatant with 8µg/mL polybrene
2. Remove medium from the cells and replace by the viral supernatant
3. Incubate for 7 hours.
4. Remove the viral preparation and add fresh preheated medium
Day 1: Selection of transduced cells
1. Remove medium and add fresh medium containing the appropriate puromycine concentration.
(600 ng/ml for CLB-GA, 800ng/ml for IMR32 and 1 µg/ml for 106C and CLB-MA).
2. For colony formation experiments, 3×104 transduced cells were plated at day 0 in 6-wells dishes and stained with crystal violet at day 10.
3. For proliferation analysis, 2×104 transduced cells were plated at day 0 in 24-wells dishes. The number of living cells was counted at day 4, 7, 10 and 14 using a Vi-cell XR counter (Beckman Coulter).
■ Immunoprecipitation
1. Prepare ice-cold lysis buffer (10 mM Tris-HCl [pH=7.4], 150 mM NaCl, 5 mM EDTA, 20 mM NaF, 25 mM β-glycerophosphate, 1 mM Na pyrophosphate, 10% glycerol, 1% NP40, 0.25 % Na deoxycholate, 1 mM Na3VO4, 1x protease inhibitor; Roche).
2. Harvest cells and wash them with PBS. Discard the supernatant and resuspend the pellet in lysis buffer. (100 µl of lysis buffer for 20×106 cells)
3. Sonicate the lysates (10 seconds - 3 times).
4. Centrifuge 30 min. at 13000 rpm at 4°C. Recover the supernatant.
5. Determine protein concentration using the BioRad Protein Assay. Cell lysates may be frozen in liquid nitrogen then stored at -80°C.
6. Incubate 250 micrograms of protein lysate with 1 µg of polyclonal ALK antibody (Zymed) for 2 hours at 4°C.
7. Add G Sepharose beads (previously washed with lysis buffer) for 1 hour at 4°C.
8. Pellet the beads by centrifugation and wash the immunoprecipitates bound to protein G Sepharose twice with lysis buffer (without Na deoxycholate).
9. Resuspend in gel loading buffer and resolved by SDS-PAGE.
■ In vitro kinase assay
1. Perform immunoprecipitations as described before until step 7.
2. Pellet the beads by centrifugation and wash the immunoprecipitates twice with buffer containing 10 mM Tris-HCl [pH=7.4], 150 mM NaCl, 5 mM EDTA, 20 mM NaF, 25 mM β-glycerophosphate, 1 mM Na pyrophosphate and 10% glycerol.
3. Wash the beads with kinase buffer (20 mM HEPES [pH=7.4], 10 mM MnCl2 and 0.5 mM Na3VO4).
4. Resuspend the beads in 40 μl of kinase buffer.
5. Perform the kinase reactions for 15 min at 20°C after adding [γ-32P ATP] (10 μCi, 6000Ci/mmol, Perkin Elmer).
6. Stop the reactions by the addition of an equal volume of gel loading buffer.
7. Perform SDS-PAGE on a 8% acrylamide gel.
8. Electrotransfer the gel onto Hybond nitrocellulose membranes (Amersham Pharmacia Biotech).
9. Detect the kinase reaction products by autoradiography of the membrane.
Troubleshooting
Critical Steps
Anticipated Results
References
Fix, A., et al. Characterization of amplicons in neuroblastoma. High-resolution mapping using DNA microarrays, relationship with outcome, and identification of overexpressed genes. Genes Chromosomes Cancer 47, 819-34 (2008).
Vincent-Salomon, A., Raynal, V., Lucchesi, C., Gruel, N. & Delattre, O. ESR1 gene amplification in breast cancer: a common phenomenon? Nat. Genet. 40, 809 (2008).
Acknowledgements
We thank Mark Lathrop and the Centre National de Génotypage for the Affymetrix 100K SNP analysis.
Keywords
Neuroblastoma, ALK, Tyrosine Kinase Receptor, mutations, kinase activity, knockdown, shRNA

